BBa_K780002 1 R37 Strong RBS for Bacillus Subtilis 2012-09-25T11:00:00Z 2015-05-08T01:13:18Z 'host-takover module' from B.subtilis Bacteriophage SPO1 Strong RBS for Bacillus Subtilis false false _1034_ 0 10113 9 It's complicated false - false Krzysztof Szczepaniak BBa_K823003 1 BBa_K823003 P_veg 2012-07-15T11:00:00Z 2015-05-08T01:13:29Z Bacillus subtilis Released HQ 2013 Pveg is a strong, constitutive promoter of Bacillus subtilis false false _1081_ 0 12081 9 In stock false no considerations false Korinna Kraft annotation2190180 1 promoter range2190180 1 1 237 BBa_R0053 1 cII p22 Promoter (p22 cII regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Bacteriophage p22. Released HQ 2013 The p22 cII regulatory region sequence is a 97 base-pair sequence with the standard BioBrick prefix and suffix sections on its ends. p22 cII repressor protein, BBa_C0053, binds to it.<br> This segment contains O-R1, O-R2, a fragment of O-R3, the -35 of P-RM, and P-R (-10 and -35 from Tom Knight)</p> false false _1_ 0 24 7 In stock false <P> <P><P> true Maia Mahoney annotation2037 1 OR1 range2037 1 34 51 annotation2035 1 OR3 range2035 1 1 3 annotation7069 1 BBa_R0053 range7069 1 1 54 annotation2042 1 -10 range2042 1 30 35 annotation2036 1 OR2 range2036 1 11 28 annotation2038 1 -35 range2038 1 18 23 annotation2041 1 -35 range2041 1 8 13 BBa_K1444025 1 BBa_K1444025 Composite promoter and weak B.subtilis RBS - C2-P22 x3 2014-10-16T11:00:00Z 2015-05-08T01:10:27Z B. subtilis A composite part consisting of the constitutive promoter Pveg <partinfo>BBa_K823003</partinfo>, followed by three copies of the repressible promoter C2-P22 <partinfo>BBa_R0053</partinfo>, and ending with the weak RBS from B. subtilis <partinfo>BBa_K780002</partinfo>. This composite part was intended to control the expression of a downstream reporter, regulated by the expression of the C2-P22 repressor protein. The constitutive promoter Pveg allows reliable expression when the repressible promoter is not repressed. The triplicate repressible promoter allows for stronger repression. false false _1822_ 0 20978 9 Not in stock false No interference with endogenous cell signalling. false Dan Ziemianowicz component2427337 1 BBa_R0053 component2427321 1 BBa_K823003 component2427330 1 BBa_R0053 component2427343 1 BBa_K780002 component2427323 1 BBa_R0053 annotation2427343 1 BBa_K780002 range2427343 1 432 447 annotation2427337 1 BBa_R0053 range2427337 1 370 423 annotation2427323 1 BBa_R0053 range2427323 1 246 299 annotation2427330 1 BBa_R0053 range2427330 1 308 361 annotation2427321 1 BBa_K823003 range2427321 1 1 237 BBa_R0053_sequence 1 aataaacttgactaaagattcctttagtagataatttaagtgttctttaatttc BBa_K780002_sequence 1 agagaacaaggagggg BBa_K823003_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagt BBa_K1444025_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagttactagagaataaacttgactaaagattcctttagtagataatttaagtgttctttaatttctactagagaataaacttgactaaagattcctttagtagataatttaagtgttctttaatttctactagagaataaacttgactaaagattcctttagtagataatttaagtgttctttaatttctactagagagagaacaaggagggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z