BBa_K1445000 1 BBa_K1445000 M13 Ori: Packaging signal for M13 phage 2014-07-27T11:00:00Z 2015-05-08T01:10:27Z M13 ori from the Litmus 28i vector Inclusion of this part on a plasmid will facilitate the uptake of the plasmid as a single-stranded phagemid into the M13 phage. Note that this part does not code for phage coat proteins so phage containing this M13 ori and your part will not multiply. Therefore, the M13K07 or similar helper phagemid is required for phage production. This part is packaged preferentially over M13K07, reducing the risk of uncontrolled phage multiplication. false false _1823_ 0 22016 9 In stock false Orientation in relation to ori may affect packaging ability. Also, 3??? end contains the promoter for the M13 gene II. This is a strong promoter and may cause unwanted expression of down stream genes. We recommend placing coding regions upstream of part. false Josephina Hendrix BBa_K1445000_sequence 1 attgatttaccccggttgataatcagaaaagccccaaaaacaggaagattgtataagcaaatatttaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagcccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcacccaaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtaaaaggatcta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z