BBa_K145012 1 UmuD N-terminal UmuD-derived degradation tag 2008-07-23T11:00:00Z 2015-05-08T01:10:28Z Derived from the 19 N-terminal amino acids of the UmuD protein. http://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene&Cmd=ShowDetailView&TermToSearch=945746&ordinalpos=1&itool=EntrezSystem2.PEntrez.Gene.Gene_ResultsPanel.Gene_RVDocSum UmuD derived N-terminal degradation tag; experimentation demonstrated that residues 1-29 of UmuD are sufficient to impart Lon recognition and degradation. false false _257_ 0 2939 9 Not in stock false none false Benjamien Moeyaert annotation1968219 1 start range1968219 1 1 3 BBa_K145012_sequence 1 atgttgtttatcaagcctgcggatctccgcgaaattgtgacttttccgctatttagcgatcttgttcagtgtggctttccttcaccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z