BBa_R0053 1 cII p22 Promoter (p22 cII regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Bacteriophage p22. Released HQ 2013 The p22 cII regulatory region sequence is a 97 base-pair sequence with the standard BioBrick prefix and suffix sections on its ends. p22 cII repressor protein, BBa_C0053, binds to it.<br> This segment contains O-R1, O-R2, a fragment of O-R3, the -35 of P-RM, and P-R (-10 and -35 from Tom Knight)</p> false false _1_ 0 24 7 In stock false <P> <P><P> true Maia Mahoney annotation2038 1 -35 range2038 1 18 23 annotation2041 1 -35 range2041 1 8 13 annotation2035 1 OR3 range2035 1 1 3 annotation2042 1 -10 range2042 1 30 35 annotation7069 1 BBa_R0053 range7069 1 1 54 annotation2036 1 OR2 range2036 1 11 28 annotation2037 1 OR1 range2037 1 34 51 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_R0084 1 OmpR Promoter (OmpR, positive) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z NC_000913 E. coli K12 Released HQ 2013 Positively regulated, OmpR-controlled promoter. This promoter is taken from the upstream region of ompF. Phosphorylated OmpR binds to the three operator sites and activates transcription. false false _1_ 0 24 7 In stock false The promoter includes three OmpR binding sites: F1, F2, and F3. The promoter starts at -107 and goes up to the transcriptional start site at +1. A distant fourth binding site, F4, has been deleted. It is involved in negative regulation of ompF (Head, Tardy and Kenney, 1998), so its deletion is intended to make the promoter solely activating. The efficacy of this promoter versus the ompC upstream region (BBa_R0082) or the truncated ompC upstream region (BBa_R0083) is currently unknown. true Stephen Lee, Roshan Kumar, Joe Levine, Ziyan Chu (Polkadorks, IAP 2004) annotation301309 1 F2 OmpR range301309 1 31 48 annotation301308 1 F1 OmpR range301308 1 11 28 annotation301318 1 -10 range301318 1 88 93 annotation301317 1 -35 range301317 1 73 78 annotation301313 1 F3 OmpR range301313 1 51 68 BBa_K145013 1 asLuxI antisense LuxI 2008-07-09T11:00:00Z 2015-05-08T01:10:28Z BBa_C0061 antisense LuxI false false _257_ 0 2970 9 In stock true just antisense true Jonas Demeulemeester BBa_C0053 1 c2 P22 c2 repressor from Salmonella phage P22 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Bacteriophage P22 Released HQ 2013 The P22 c2 repressor protein coding sequence is a 720 base-pair sequence with the standard RBS-compatible BioBrick prefix and the standard BioBrick suffix sections on its ends. It binds to the P22 c2 regulatory sequence, BBa_R0053. The sequence contains a LVA tag for faster degredation.</p> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Vander Byl,C. and Kropinski,A.M. <em>Sequence of the genome of Salmonella bacteriophage P22</em><br> J. Bacteriol. 182 (22), 6472-6481 (2000) <P> References (unparsed) here: <p>Vander Byl,C. and Kropinski,A.M. <em>Sequence of the genome of Salmonella bacteriophage P22</em><br> J. Bacteriol. 182 (22), 6472-6481 (2000) <P><P> true Maia Mahoney annotation1751 1 stop range1751 1 682 687 annotation7036 1 BBa_C0053 range7036 1 1 687 annotation1750 1 LVA range1750 1 649 681 annotation1747 1 cII p22 range1747 1 1 648 annotation2213993 1 Help:Barcodes range2213993 1 688 712 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K145101 1 BBa_K145101 OmpF PoPS -> deactivate constitutive antisense LuxI 2008-07-09T11:00:00Z 2015-05-08T01:10:28Z other parts Memory device in which P2ogr is under control of OmpF and Psid double promotor. P2ogr will also activate transcription of cII from a seperate Psid promotor. This cII represses transcription of antisense LuxI from a P22 promotor. false false _257_ 0 2970 9 Not in stock false validate dual promotor system! false Jonas Demeulemeester component2235239 1 BBa_R0084 component2235243 1 BBa_B0032 component2235274 1 BBa_R0053 component2235259 1 BBa_B0032 component2235255 1 BBa_B0015 component2235257 1 BBa_I746364 component2235287 1 BBa_B0015 component2235272 1 BBa_B0015 component2235262 1 BBa_C0053 component2235248 1 BBa_I746350 component2235280 1 BBa_K145013 component2235241 1 BBa_I746364 annotation2235280 1 BBa_K145013 range2235280 1 1660 2277 annotation2235248 1 BBa_I746350 range2235248 1 239 475 annotation2235241 1 BBa_I746364 range2235241 1 117 209 annotation2235262 1 BBa_C0053 range2235262 1 741 1427 annotation2235259 1 BBa_B0032 range2235259 1 722 734 annotation2235287 1 BBa_B0015 range2235287 1 2286 2414 annotation2235257 1 BBa_I746364 range2235257 1 621 713 annotation2235274 1 BBa_R0053 range2235274 1 1598 1651 annotation2235239 1 BBa_R0084 range2235239 1 1 108 annotation2235243 1 BBa_B0032 range2235243 1 218 230 annotation2235255 1 BBa_B0015 range2235255 1 484 612 annotation2235272 1 BBa_B0015 range2235272 1 1461 1589 BBa_I746364 1 BBa_I746364 Psid promoter from P4 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z P4 phage genome Released HQ 2013 This is the Psid promoter taken from the P4 phage genome. It is an inducible promoter that is activated by a class of activators, including P2 ogr (I746350), PSP3 pag (I746351) and phiR73 delta (I746352). These different activators should cause different levels of activity of the Psid promoter. false false _116_ 0 2122 9 In stock false no special considerations true Stefan Milde annotation1943787 1 Psid range1943787 1 1 93 BBa_I746350 1 BBa_I746350 ogr activator from P2 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z plasmid DNA supplied by Prof. Richard Calendar, University of California. The ogr activator taken from P2 phage acts on a class of inducible promoters (parts I746360 to I746365), inducing their activity to varying degrees. The part sequence does already contain a ribosome binding site (B0034)! false false _116_ 0 2122 9 In stock true The part does contain a RBS (B0034) already. true Stefan Milde annotation1943866 1 P2 ogr range1943866 1 19 19 annotation1943867 1 P2 ogr range1943867 1 19 237 annotation1943865 1 B0034 range1943865 1 1 12 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0053_sequence 1 aataaacttgactaaagattcctttagtagataatttaagtgttctttaatttc BBa_I746350_sequence 1 aaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaa BBa_K145013_sequence 1 ttattaagctactaaagcgtagttttcgtcgtttgcagcatttaagactgcttttttaaactgttcattaataggcatagacaatacaaccgatttagtatcacctaatacatgaatttctttgtctccaatacgatgacaaggaactttaatacgctttaaaaatcgctctattgctgttgatgttactgttacatattctgtaataccttgactaacagcgtgtttatatatagcttcaaatagtttcattgtaatttcactagcagagttatttatctttgagctatttttacctacagcaaaacgacttaattcgactatattaggatctttgggagcactctgttgaccaagcaattcaggaaaaacacttttcagcatataatcacctgttgtaggtaataaacgccagcatccacttacattttcagtatcatcacaagcataaatatattctgcatttgagttatcatactcatctgattcaaggttattttctacaactaagtcccactcaagtctttgcttaaacacttgataacgaagacttagaatacctttatactcctccgatggaattgccaaaaaatccgatttttttatcattatagtcat BBa_B0032_sequence 1 tcacacaggaaag BBa_I746364_sequence 1 tggcttgccggtctgaggatgagtctcctgtgtcagggctggcacatctgcaatgcgtcgtgttgttgtccggtgtacgtcacaattttctta BBa_R0084_sequence 1 cttaaattttacttttggttacatattttttctttttgaaaccaaatctttatctttgtagcactttcacggtagcgaaacgttagtttgaatggaaagatgcctgca BBa_C0053_sequence 1 atgaatacacaattgatgggtgagcgtattcgcgctcgaagaaaaaaactcaagattagacaagccgctcttggtaagatggtgggagtgtctaatgttgcaatatcgcaatgggagcgctcggagactgagccaaatggggagaacctgttggcactttcgaaggctcttcagtgctcccctgactatttgctgaaaggagatttaagccagacaaacgttgcctatcatagtaggcatgagccaagaggatcataccctcttatcagttgggtaagcgcagggcaatggatggaagctgtagaaccttatcacaagcgcgcgatagagaactggcacgacaccactgtagattgttcagaagattcattttggcttgatgtccaaggtgactctatgacagcaccggcagggttaagcattccagaaggaatgataattctggttgatcccgaagtcgaaccaagaaacggcaagctggttgttgcaaaattagaaggtgaaaacgaggccacattcaaaaaattagttatggatgcaggccgaaagtttttaaaaccattaaacccacaatatccgatgatagaaatcaacggaaactgcaaaatcattggcgtagttgttgacgcaaaactcgcaaatcttccagctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_K145101_sequence 1 cttaaattttacttttggttacatattttttctttttgaaaccaaatctttatctttgtagcactttcacggtagcgaaacgttagtttgaatggaaagatgcctgcatactagagtggcttgccggtctgaggatgagtctcctgtgtcagggctggcacatctgcaatgcgtcgtgttgttgtccggtgtacgtcacaattttcttatactagagtcacacaggaaagtactagagaaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtggcttgccggtctgaggatgagtctcctgtgtcagggctggcacatctgcaatgcgtcgtgttgttgtccggtgtacgtcacaattttcttatactagagtcacacaggaaagtactagatgaatacacaattgatgggtgagcgtattcgcgctcgaagaaaaaaactcaagattagacaagccgctcttggtaagatggtgggagtgtctaatgttgcaatatcgcaatgggagcgctcggagactgagccaaatggggagaacctgttggcactttcgaaggctcttcagtgctcccctgactatttgctgaaaggagatttaagccagacaaacgttgcctatcatagtaggcatgagccaagaggatcataccctcttatcagttgggtaagcgcagggcaatggatggaagctgtagaaccttatcacaagcgcgcgatagagaactggcacgacaccactgtagattgttcagaagattcattttggcttgatgtccaaggtgactctatgacagcaccggcagggttaagcattccagaaggaatgataattctggttgatcccgaagtcgaaccaagaaacggcaagctggttgttgcaaaattagaaggtgaaaacgaggccacattcaaaaaattagttatggatgcaggccgaaagtttttaaaaccattaaacccacaatatccgatgatagaaatcaacggaaactgcaaaatcattggcgtagttgttgacgcaaaactcgcaaatcttccagctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagaataaacttgactaaagattcctttagtagataatttaagtgttctttaatttctactagagttattaagctactaaagcgtagttttcgtcgtttgcagcatttaagactgcttttttaaactgttcattaataggcatagacaatacaaccgatttagtatcacctaatacatgaatttctttgtctccaatacgatgacaaggaactttaatacgctttaaaaatcgctctattgctgttgatgttactgttacatattctgtaataccttgactaacagcgtgtttatatatagcttcaaatagtttcattgtaatttcactagcagagttatttatctttgagctatttttacctacagcaaaacgacttaattcgactatattaggatctttgggagcactctgttgaccaagcaattcaggaaaaacacttttcagcatataatcacctgttgtaggtaataaacgccagcatccacttacattttcagtatcatcacaagcataaatatattctgcatttgagttatcatactcatctgattcaaggttattttctacaactaagtcccactcaagtctttgcttaaacacttgataacgaagacttagaatacctttatactcctccgatggaattgccaaaaaatccgatttttttatcattatagtcattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z