BBa_K145151 1 ccdB ccdB coding region 2008-08-06T11:00:00Z 2015-07-08T03:14:50Z P1010 Released HQ 2013 Coding region for the ccdB (control of cell death) gene. true false _257_ 4206 2970 9 In stock true just one stop codon in the end true Jonas Demeulemeester annotation1970253 1 cds range1970253 1 1 303 annotation1970252 1 stop range1970252 1 304 306 annotation1970251 1 start range1970251 1 1 3 BBa_K145109 1 BBa_K145109 Hybrid P22 c2 - luxP_R PoPS -> ccdB 2008-07-09T11:00:00Z 2015-07-09T01:35:58Z other parts ccdB cell death gene under the control of a LuxP_R promotor. true false _257_ 4206 2970 9 Not in stock false Could change RBS strength if necessary false Jonas Demeulemeester component1970593 1 BBa_B0010 component1970592 1 BBa_K145151 component1970585 1 BBa_K145150 component1970595 1 BBa_B0012 component1970587 1 BBa_B0032 annotation1970593 1 BBa_B0010 range1970593 1 408 487 annotation1970592 1 BBa_K145151 range1970592 1 94 399 annotation1970587 1 BBa_B0032 range1970587 1 75 87 annotation1970585 1 BBa_K145150 range1970585 1 1 66 annotation1970595 1 BBa_B0012 range1970595 1 496 536 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K145150 1 BBa_K145150 Hybrid promoter: HSL-LuxR activated, P22 C2 repressed 2008-08-05T11:00:00Z 2015-05-08T01:10:29Z Synthetic Hybrid promoter consisting of the Lux box which overlaps partly with -35 box. Binding sites for P22 C2 O_R2 and O_R1 are located between the -35 and -10 boxes and downstream of them respectively. false false _257_ 0 2970 9 It's complicated false -35 box is partly composite. -10 is taken from the P22 phage P_R regulatory region true Jonas Demeulemeester annotation1971583 1 -35 range1971583 1 20 25 annotation1971585 1 -10 range1971585 1 42 47 annotation1971586 1 OR1 range1971586 1 46 63 annotation1971584 1 OR2 range1971584 1 23 40 annotation1971582 1 Lux-box range1971582 1 1 20 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K145109_sequence 1 acctgtaggatcgtacaggtttactaaagattcctttagtttataatttaagtgttctttaatttctactagagtcacacaggaaagtactagatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K145151_sequence 1 atgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataa BBa_B0032_sequence 1 tcacacaggaaag BBa_K145150_sequence 1 acctgtaggatcgtacaggtttactaaagattcctttagtttataatttaagtgttctttaatttc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z