BBa_K1452001 1 BBa_K1452001 Pos/neg selection (Bacillus) 2014-11-02T12:00:00Z 2015-06-01T02:28:44Z http://www.bgsc.org/viewdetail.php?bgscid=ECE194&Search=pDGieF http://www.ncbi.nlm.nih.gov/pubmed/16714443 This is a positive/negative selection cassette for Bacillus. If flanked by Bacillus integration sites and integration sites for any chosen DNA, that DNA can be integrated into Bacillus and then the selection cassette can be integrated over by whatever DNA you chose. false false _1830_ 4206 14964 9 In stock false ***the mazF toxin is unstable in plasmids without the mazE antitoxin*** false Keoni Gandall component2430143 1 BBa_K302033 annotation2430143 1 BBa_K302033 range2430143 1 1 339 BBa_K302033 1 BBa_K302033 mazF 2010-10-24T11:00:00Z 2015-06-01T02:27:54Z ''Bacillus Subtilis'' 168 strain Encodes a stable non-specific ribonuclease in ''Bacillus Subtilis''. It is used in conjungtion with ''mazE'' in ''Bacillus Subtilis'' to provide a toxin-antitoxin in various stressful conditions. When transcribtion of both genes is turned off (as both are under contol of same promoter) ''mazE'' will be degraded faster than ''mazF''. There is then no inhibiton of ''mazF'', killing the cell. false false _442_ 4206 6345 9 In stock false Sequence isolated based upon the work of Pellegrini, O., Mathy, N., Gogos, A., Shapiro, L., and Condon, C. (2005) The ''Bacillus subtilis'' ydcDE operon encodes an endoribonuclease of the MazF/PemK family and its inhibitor. ''Mol Microbiol'' 56: 1139???1148. false Philip Hall annotation2099798 1 double TAA added range2099798 1 334 339 BBa_K1452001_sequence 1 atggtaagccgatacgtacccgatatgggcgatctgatttgggttgattttgacccgacaaaaggtagcgagcaagctggacatcgtccagctgttgtcctgagtcctttcatgtacaacaacaaaacaggtatgtgtctgtgtgttccttgtacaacgcaatcaaaaggatatccgttcgaagttgttttatccggtcaggaacgtgatggcgtagcgttagctgatcaggtaaaaagtatcgcctggcgggcaagaggagcaacgaagaaaggaacagttgccccagaggaattacaactcattaaagccaaaattaacgtactgattgggtaataa BBa_K302033_sequence 1 atggtaagccgatacgtacccgatatgggcgatctgatttgggttgattttgacccgacaaaaggtagcgagcaagctggacatcgtccagctgttgtcctgagtcctttcatgtacaacaacaaaacaggtatgtgtctgtgtgttccttgtacaacgcaatcaaaaggatatccgttcgaagttgttttatccggtcaggaacgtgatggcgtagcgttagctgatcaggtaaaaagtatcgcctggcgggcaagaggagcaacgaagaaaggaacagttgccccagaggaattacaactcattaaagccaaaattaacgtactgattgggtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z