BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K145015 1 GFP GFP with LVA tag 2008-07-31T11:00:00Z 2015-05-08T01:10:28Z pJBA111, carrying GFP-LVA, was generously provided by Dr. S. Molin, The Technical University of Denmark, Lyngby Appl Environ Microbiol. 1998 Jun;64(6):2240-6. New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria. Andersen JB, Sternberg C, Poulsen LK, Bjorn SP, Givskov M, Molin S. PMID: 9603842 Green Fluorescent Protein with LVA tag for rapid degradation false false _257_ 0 2939 9 It's complicated true Designed out of pJBA111 (Molin, 1998) with PCR to add appropriote prefix and suffix. true Benjamien Moeyaert annotation1969617 1 stop range1969617 1 754 756 annotation1969616 1 start range1969616 1 1 3 annotation1969620 1 cds range1969620 1 4 716 annotation1969619 1 LVA tag range1969619 1 717 753 annotation1969618 1 stop range1969618 1 757 759 BBa_K145205 1 BBa_K145205 OUTPUT GFP under TetR pomoter 2008-08-19T11:00:00Z 2015-05-08T01:10:29Z other parts OUTPUT GFP with an LVA tag under the control of the OmpF pomoter, which is activated by a low concentration and repressed by a high concentration of phosphorylated OmpR. false false _257_ 0 2970 9 It's complicated true When light hits the lightsensor M30109 (K145000). It's kinase activity will be inhibited and only a small amount of OmpR-P is produced. This means the OmpF promoter will be actively used for transcription. true Jonas Demeulemeester component1973985 1 BBa_R0040 component1973997 1 BBa_K145015 component1974000 1 BBa_B0012 component1973998 1 BBa_B0010 component1973990 1 BBa_B0032 annotation1973998 1 BBa_B0010 range1973998 1 849 928 annotation1973985 1 BBa_R0040 range1973985 1 1 54 annotation1973990 1 BBa_B0032 range1973990 1 63 75 annotation1974000 1 BBa_B0012 range1974000 1 937 977 annotation1973997 1 BBa_K145015 range1973997 1 82 840 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0032_sequence 1 tcacacaggaaag BBa_K145205_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaaaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K145015_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaaaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z