BBa_K145013 1 asLuxI antisense LuxI 2008-07-09T11:00:00Z 2015-05-08T01:10:28Z BBa_C0061 antisense LuxI false false _257_ 0 2970 9 In stock true just antisense true Jonas Demeulemeester BBa_K145211 1 BBa_K145211 MEMORY OUTPUT asLuxI 2008-08-19T11:00:00Z 2015-05-08T01:10:29Z other parts + synthesis MEMORY OUTPUT This device generates antisense LuxI only if the memory (K145210) is in the OFF state false false _257_ 0 2970 9 Not in stock false antisense LuxI is full length false Jonas Demeulemeester component2220412 1 BBa_K145013 component2220406 1 BBa_R1052 component2220419 1 BBa_B0015 annotation2220406 1 BBa_R1052 range2220406 1 1 46 annotation2220412 1 BBa_K145013 range2220412 1 55 672 annotation2220419 1 BBa_B0015 range2220419 1 681 809 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_R1052 1 cI 434 Promoter, Standard (434 cI regulated)<br> 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z Bacteriophage 434 right operator [Note: This is the same part as R0052 except that the -10 and -35 sites and spacing have been changed to comply with BBa_S0001].<br><br>The 434 cI regulatory region sequence is a 89 base-pair sequence with the standard BioBrick prefix and suffix sections on its ends. 434 cI repressor protein, <bb_part>BBa_C0052<bb_part>, binds to it.<br> This segment contains O-R1, O-R2, P-R, and P-RM -35.</p> false false _1_ 0 24 7 It's complicated false <P> <P>Wild-type promoter modified to comply with BBa_S0001:<br> TTGACA-17N-GATACT<br><P> false Maia Mahoney, Drew Endy annotation2081 1 OR1 range2081 1 30 43 annotation2087 1 -10 range2087 1 24 29 annotation2083 1 -35 range2083 1 2 7 annotation2082 1 -35 range2082 1 1 6 annotation2080 1 OR2 range2080 1 8 21 annotation7075 1 BBa_R1052 range7075 1 1 46 annotation2084 1 start range2084 1 35 37 annotation2079 1 -10 range2079 1 1 43 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K145211_sequence 1 ttgacaaacaagatacattgtatgatactacaagaaagtttgttgatactagagttattaagctactaaagcgtagttttcgtcgtttgcagcatttaagactgcttttttaaactgttcattaataggcatagacaatacaaccgatttagtatcacctaatacatgaatttctttgtctccaatacgatgacaaggaactttaatacgctttaaaaatcgctctattgctgttgatgttactgttacatattctgtaataccttgactaacagcgtgtttatatatagcttcaaatagtttcattgtaatttcactagcagagttatttatctttgagctatttttacctacagcaaaacgacttaattcgactatattaggatctttgggagcactctgttgaccaagcaattcaggaaaaacacttttcagcatataatcacctgttgtaggtaataaacgccagcatccacttacattttcagtatcatcacaagcataaatatattctgcatttgagttatcatactcatctgattcaaggttattttctacaactaagtcccactcaagtctttgcttaaacacttgataacgaagacttagaatacctttatactcctccgatggaattgccaaaaaatccgatttttttatcattatagtcattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K145013_sequence 1 ttattaagctactaaagcgtagttttcgtcgtttgcagcatttaagactgcttttttaaactgttcattaataggcatagacaatacaaccgatttagtatcacctaatacatgaatttctttgtctccaatacgatgacaaggaactttaatacgctttaaaaatcgctctattgctgttgatgttactgttacatattctgtaataccttgactaacagcgtgtttatatatagcttcaaatagtttcattgtaatttcactagcagagttatttatctttgagctatttttacctacagcaaaacgacttaattcgactatattaggatctttgggagcactctgttgaccaagcaattcaggaaaaacacttttcagcatataatcacctgttgtaggtaataaacgccagcatccacttacattttcagtatcatcacaagcataaatatattctgcatttgagttatcatactcatctgattcaaggttattttctacaactaagtcccactcaagtctttgcttaaacacttgataacgaagacttagaatacctttatactcctccgatggaattgccaaaaaatccgatttttttatcattatagtcat BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R1052_sequence 1 ttgacaaacaagatacattgtatgatactacaagaaagtttgttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z