BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_J23008 1 BBa_J23008 [key3c] riboregulator for lock3 variants 2006-07-09T11:00:00Z 2015-08-31T04:08:38Z J23007 This part has the same homology region to J01122 as J23007 except that unlike J23007, J23008 does not contain the hairpin that was derived from J01129. J23008 anneals linearly to the stem of the hairpin in J01122 with perfect base pairing and destroys the hairpin in the process and reveals the RBS on J01122. When J01122 is transcribed the RNA secondary structure is such that the RBS hairpins with sequence upstream preventing the ribosome from binding and translation from occuring thereby locking up RFP further down stream. When J23008 is introduced into the cell in trans, we suspect that it will unlock the RBS for RFP as described above allowing translation to occur. false false _52_ 0 931 52 In stock false No design considerations true Kaitlin Davis BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K145215 1 BBa_K145215 FILTER Key (TetR promoter + key) 2008-08-19T11:00:00Z 2015-05-08T01:10:29Z other parts Released HQ 2013 FILTER This device was designed to filter out noise in an input signal; in our case OmpF PoPs. If there is a short increase in transcription from this promoter, a small amount of J23066 RiboKey is produced. This is then used to unlock (J23078) the short lived UmuD-tagged T7 RNA polymerase. This results in an increase of active T7 protein. The final part of this filter is an AND gate which is used in the components further on in the system. This AND gate consists of a T7 RNA polymerase promoter with another RiboLock (J23078 again). The AND gate will only function if the duration of the noise is sufficiently long and intense (= a signal) in order to have both the short-lived RiboKey AND T7 polymerase available at the same time and thus to produce the component. false false _257_ 0 2970 9 In stock true We did a lot of modeling on this device. The most efficient Berkeley 2006 key and lock have been used. The RiboKy might be required in higher copy number although modeling doesn't predict this. true Jonas Demeulemeester component1974069 1 BBa_B0010 component1974068 1 BBa_J23009 component1974067 1 BBa_J23008 component1974071 1 BBa_B0012 component1974063 1 BBa_R0040 annotation1974063 1 BBa_R0040 range1974063 1 1 54 annotation1974068 1 BBa_J23009 range1974068 1 165 261 annotation1974071 1 BBa_B0012 range1974071 1 358 398 annotation1974069 1 BBa_B0010 range1974069 1 270 349 annotation1974067 1 BBa_J23008 range1974067 1 63 156 BBa_J23009 1 BBa_J23009 [key3d] riboregulator for lock3 variants 2006-08-02T11:00:00Z 2015-08-31T04:08:38Z Overlap extension Variant of key3 (see part J01129 (key3), J23007(key3b), J23008(key3c)). Part is in pJ23006, so there is a Ptet upstream of the XbaI site to drive expression. Nevertheless, J23009 is still a basic part allowing both prefix and suffix insertions. false false _52_ 0 483 95 In stock false N/A true John Anderson BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K145215_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagacccaaaagcaagaggtgattctagttggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctttactagagcgggcgggcgggcgggcgggatccataaaaaaaaaacccaaaagcaagaggtgattctagttaaaaaaaaaaagcttcccgcccgcccgcccgcccgtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_J23008_sequence 1 acccaaaagcaagaggtgattctagttggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctt BBa_J23009_sequence 1 cgggcgggcgggcgggcgggatccataaaaaaaaaacccaaaagcaagaggtgattctagttaaaaaaaaaaagcttcccgcccgcccgcccgcccg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z