BBa_K1453400 1 BBa_K1453400 Enzyme USB(AarI) 2014-10-16T11:00:00Z 2015-05-08T01:10:30Z This part are synthesized by company. SS false false _1831_ 0 21355 9 Not in stock false Our target enzyme can be inserted into our part easily. false Binhan Hao annotation2422882 1 SduI recognition site range2422882 1 188 193 annotation2422879 1 AarI recognition site range2422879 1 70 76 annotation2422880 1 AarI recognition site range2422880 1 128 134 annotation2426966 1 BBa_K1453400 range2426966 1 1 195 annotation2422883 1 flexible linker range2422883 1 9 61 annotation2422884 1 flexible linker range2422884 1 139 195 annotation2422881 1 useless sequence range2422881 1 77 127 annotation2422878 1 Bsu36I recognition site range2422878 1 7 13 BBa_K1453400_sequence 1 gaaattccttaggaggtggaggtagtggtggaggtggaagtggtggaggtggtagtgccgctgctaattgcaggtgcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttctgtcacctgcttaattaggaggtggaggtagtggtggaggtggaagtggtggaggtggtagtggtgcacct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z