BBa_K1453401 1 BBa_K1453401 Enzyme USB(BsmAI) 2014-10-16T11:00:00Z 2015-05-08T01:10:30Z This part are synthesized by company. S false false _1831_ 0 21355 9 Not in stock false The target enzyme can be easily inserted into our part. false Binhan Hao annotation2422888 1 BsmAI recognition site range2422888 1 123 127 annotation2422890 1 flexible linker range2422890 1 9 61 annotation2422886 1 BsmAI recognition site range2422886 1 67 71 annotation2422889 1 SduI recognition site range2422889 1 178 183 annotation2422885 1 Bsu36I recognition site range2422885 1 7 13 annotation2426967 1 BBa_K1453401 range2426967 1 1 185 annotation2422887 1 useless sequence range2422887 1 72 122 annotation2422891 1 flexible linker range2422891 1 129 185 BBa_K1453401_sequence 1 gaaattccttaggaggtggaggtagtggtggaggtggaagtggtggaggtggtagtgccgctgcttgagaccggttttttcctgtttggtcactgatgcctccgtgtaagggggatttctgtgtctcattaggaggtggaggtagtggtggaggtggaagtggtggaggtggtagtggtgcacct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z