BBa_K1453500 1 BBa_K1453500 New TAL_left_right 2014-10-15T11:00:00Z 2015-05-08T01:10:30Z The parts are synthesized by biological company. sd false false _1831_ 0 21355 9 Not in stock false It has the best sticky ends you can find on the sequence. BsmBI can digest these parts and get a 4bp sticky end at last. You can use golden gate method to ligate 7 parts of New TAL and get a whole TALE. false Binhan Hao annotation2421743 1 TAL T1 range2421743 1 95 194 annotation2421746 1 sticky end-7 range2421746 1 320 323 annotation2421744 1 TAL T14 range2421744 1 340 441 annotation2427007 1 BBa_K1453500 range2427007 1 1 496 annotation2421742 1 flexible linker range2421742 1 38 94 annotation2421745 1 sticky end-1 range2421745 1 200 203 annotation2421740 1 BsmBI recognition site range2421740 1 205 211 annotation2421741 1 BsmBI recognition site range2421741 1 313 318 BBa_K1453500_sequence 1 ggatccgtattcgagctcggcgcgccgcggccgcatgttaggaggtggaggtagtggtggaggtggaagtggtggaggtggtagtggtgcacctctggacacgggccagttgctgaagatcgcgaagcggggaggagtcacggcggtcgaggcggtgcacgcgtggcgcaatgcgctcacgggagcacccctcaactgaccccggagacgcctgaccccggaacaggtggtggccattgcctccaatattggtggcaagcaagccctggaaaccgttcagcggctgctgccagtcctgtgccaggcacacggcgtctcattttgtgtcaggcccacggactcacgcctgagcaggtagtggctattgcatccaacggagggggcagacccgcactggagtcaatcgtggcccagctttcgaggccggaccccgcgctggcccaccaccaccaccaccactaaggatccgtattcgagctcggcgcgccgcggccgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z