BBa_K1456004 1 BBa_K1456004 Hypoxia Response Element(HRE) 2014-07-20T11:00:00Z 2015-05-08T01:10:31Z We clonned this part from human hepatocellular carcinoma cell genome cDNA HRE is a enhancer and regulate gene transcription depend on hypoxia. false false _1834_ 0 17366 9 In stock true This part will help our cells to sense hypoxic conditions in order to activate our other vital parts that allow oxygen re-support. false safa tapan BBa_K1456004_sequence 1 ctcgagacgtgagcgacgtgctcgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z