BBa_K1456007 1 BBa_K1456007 Superoxide dismutase-1 (SOD-1) Forward primer with restriction site and kozak sequence 2014-08-12T11:00:00Z 2015-05-08T01:10:31Z none we use this primer to prepare our Superoxide dismutase-1SOD-1)enzyme from cDNA. false false _1834_ 0 17366 9 Not in stock false none false safa tapan BBa_K1456007_sequence 1 ggaattcggatcctctagatcgagcggccgccactatggcgacgaaggccgtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z