BBa_K1456010 1 BBa_K1456010 Glutathione Peroxidase (GPx) enzyme reverse primer with restriction site, two stop codon and 6X His 2014-08-12T11:00:00Z 2015-05-08T01:10:31Z none we use this primer to prepare our Glutathione Peroxidase (GPx) enzyme from cDNA. false false _1834_ 0 17366 9 Not in stock false none false safa tapan BBa_K1456010_sequence 1 gctgcagggatccactagtttactagtggtgatggtgatgatgggcacagctgggccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z