BBa_K1456012 1 BBa_K1456012 Human Tissue Plasminogen Activator reverse primer with restriction site, 2 stop codons and 6X His 2014-08-12T11:00:00Z 2015-05-08T01:10:31Z none We use this primer to prepare our Human Tissue Plasminogen Activator (tPA) enzyme from cDNA. false false _1834_ 0 20835 9 Not in stock false none false Mustafa Yılmaz BBa_K1456012_sequence 1 gctgcagggatccactagtttatcagtggtgatggtgatgatgcggtcgcatgttgtcacga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z