BBa_K1458004 1 BBa_K1458004 Human AdipoQ gene 2014-10-14T11:00:00Z 2015-05-08T01:10:32Z Human adiponectin on NCBI : http://www.ncbi.nlm.nih.gov/gene/9370 The AdipoQ gene which codes for the protein adiponectin has domains similar to collagens X and VIII and complement factor C1q. Adiponectin forms multimeric complexes that combine via its collagen domains to create three major oligomeric forms: a low molecular weight (LMW) trimer, a middle - molecular weight (MMW) hexamer, and high molecular weight (HMW) 12-18- mer Adiponectin. Normally it is expressed exclusively in adipose tissues from which it is secreted to the blood stream. It directly sensitizes the body to insulin and has an important role in lipid and glucose metabolism regulation. Therefore adiponectin represents a potential therapeutic target to fighting obesity-linked diseases characterized by insulin resistance and the Metabolic Syndrom. Furthermore low levels of serum Adiponectin is highly related with occurrence of abdominal obesity, insulin resistance, type 2 diabetes, and the metabolic syndrome. false false _1836_ 0 21457 9 Not in stock false . false Shani Gal-Oz BBa_K1458004_sequence 1 atgctgttgctgggagctgttctactgctattagctctgcccggtcatgaccaggaaaccacgactcaagggcccggagtcctgcttcccctgcccaagggggcctgcacaggttggatggcgggcatcccagggcatccgggccataatggggccccaggccgtgatggcagagatggcacccctggtgagaagggtgagaaaggagatccaggtcttattggtcctaagggagacatcggtgaaaccggagtacccggggctgaaggtccccgaggctttccgggaatccaaggcaggaaaggagaacctggagaaggtgcctatgtataccgctcagcattcagtgtgggattggagacttacgttactatccccaacatgcccattcgctttaccaagatcttctacaatcagcaaaaccactatgatggctccactggtaaattccactgcaacattcctgggctgtactactttgcctaccacatcacagtctatatgaaggatgtgaaggtcagcctcttcaagaaggacaaggctatgctcttcacctatgatcagtaccaggaaaataatgtggaccaggcctccggctctgtgctcctgcatctggaggtgggcgaccaagtctggctccaggtgtatggggaaggagagcgtaatggactctatgctgataatgacaatgactccaccttcacaggctttcttctctaccatgacaccaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z