BBa_K1459005 1 BBa_K1459005 PmrA-PmrB(N-term) from Salmonella 2014-10-06T11:00:00Z 2015-05-08T01:10:32Z We obtained PmrA-PmrB sequences thanks to kindness of prof. He from the University of Chicago. This is N-terminal part of PmrA-PmrB two-component system native to Salmonella enterica. PmrA-PmrB two-component system is native to Salmonella enterica and in it's native state it is responsible for chemotaxis. PmrB is a transmembrane protein with iron binding peptide on it's extracellular loop. When PmrB binds iron (III) iron, it's intracellular domain gains kinase activity and phosphorylates PmrA, which subsequently binds to pmrC promoter and induces expression of chemotaxis CheZ protein. In this part iron binding tag on the extracellular loop was exchanged with a lanthanide binding tag (LBT), to allow PmrA-PmrB two-component system to respond to lanthanide ions. In this part, PmrB protein is truncated just before iron binding tag, which enables one to put any desired tag between two parts of PmrB, to construct a detecting system based on PmrA-PmrB system. false false _1837_ 0 20803 9 It's complicated false We had to truncate PmrB sequence just before the iron binding tag. false Grzegorz Ścibisz BBa_K1459005_sequence 1 atgaagatactgattgttgaagacgacacgctattattacaggggttaatactcgccgcgcaaaccgaaggctatgcgtgtgatggcgtttcgacagcgcgtgccgccgagcatagtctggagtctggtcattacagtctgatggtgctggatttagggctgcccgatgaggatggcctgcatttcctgacgcgaatccgacagaaaaaatacaccctgccggtactcattctgaccgcccgcgatacgctcaacgaccgcattagcgggctggatgtcggcgcagatgattatctggtaaaacccttcgccctggaggagctgcacgcccgcatccgcgcgttgctgcgccgccataataaccagggtgaaagtgaactgacggttggcaatctgacgctcaatataggccgccatcaggcatggagggatggacaggaactgaccctgacgcctaaggagtacgcgctgctctcacgattgatgctcaaggcaggcagtccggtgcaccgggaaattctttataacgatatctacaactgggataacgaaccctcgaccaacactctggaagtgcatatacataatttgcgcgacaaagtcggcaagtcgcgcattcgcacggttcgcaggtttggctacatgctggttgccactgaggaaagctaagtgagcctgatgcgttttcagcgaagagcgatgacccttcgccagcgtttaacgctgacaattggtcttattctgctggtgttccagctaatcagtaccttctggttatgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z