BBa_K1459006 1 BBa_K1459006 pmrC 2014-10-06T11:00:00Z 2015-05-08T01:10:32Z We obtained the pmrC-GFP sequence thanks to kindness of prof. He from University of Chicago. This is pmrC promoter native to Salmonella enterica. PmrA-PmrB two-component system is native to Salmonella enterica and in it's native state it is responsible for chemotaxis. PmrB is a transmembrane protein with iron binding peptide on it's extracellular loop. When PmrB binds iron (III) iron, it's intracellular domain gains kinase activity and phosphorylates PmrA, which subsequently binds to pmrC promoter and induces expression of chemotaxis CheZ protein. In this part iron binding tag on the extracellular loop was exchanged with a lanthanide binding tag (LBT), to allow PmrA-PmrB two-component system to respond to lanthanide ions. false false _1837_ 0 20803 9 Not in stock false This is pmrC sequence derived from bioinformatic sources, after search for promotor at 5' end of CheZ protein. false Grzegorz Ścibisz BBa_K1459006_sequence 1 tcaccctggtgccttatctttacacctgtgcggcgttactgctgctcggacacggtcactttggtaaagcacgcccggcatatctggcagttactaccattgccttcctctactgcatctgggccgtggtggggtccggagcgaaagaggttatgtggtcatttgtcaccctgatggtcatcaccgccatgtatgcgctgaattacaaccggctacataaaaacccgtatcccttagatgcaccaataagcaaagattaattccccttaatccagcaaacataaaagccaaccttaagaacttaaggttggcttaattttgctttgcgagcatatgcgcactttgttcgatggaaacaccgtggtacccggggatcctctataattaaagaggagaaattaagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z