BBa_K1459012 1 BBa_K1459012 SENG lanthanide binding tag 2014-10-12T11:00:00Z 2015-05-08T01:10:32Z This LBT was described in paper This is a DNA sequence coding lanthanide binding tag described in literature. It's literatural dissociation constants are as follows: K(Tb)=18 nM This is the lowest known value of dissociation constant, thus making the binding strenght highest amongst known LBTs. false false _1837_ 0 20803 9 Not in stock false Only aminoacid sequence is given in publication, so we had to reversely translate it, considering most often used codons in E. coli. false Grzegorz Ścibisz BBa_K1459012_sequence 1 tttattgataccaacaacgatggctggattgaaggcgatgaactgctgctggaagaaggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z