BBa_K1459013 1 BBa_K1459013 wSE3 lanthanide binding tag 2014-10-12T11:00:00Z 2015-05-08T01:10:32Z This LBT was described in paper This is sequence of DNA coding wSE3 lanthanide binding tag. It's dissociation constants are as follows: K(Tb)=2000 nM false false _1837_ 0 20803 9 Not in stock false Since all LBTs are peptides and shown as aminoacid sequence, we had to reversely translate them into DNA taking E. coli most used codons as reference. false Grzegorz Ścibisz BBa_K1459013_sequence 1 tatattgataccaacaacgatggctggattgatattgatgaactgctggcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z