BBa_K1459014 1 BBa_K1459014 Lanthanide Binding Tag 2014-10-12T11:00:00Z 2015-05-08T01:10:32Z This LBT was described in paper This is DNA sequence coding a lanthanide binding tag. This one is one of the best described LBTs in literature, with dissociation constants following: K(La)= 3500 nM K(Ce)= 950 nM K(Nd)= 270 nM K(Eu)= 62 nM K(Gd)= 84 nM K(Tb)= 57 nM K(Dy)= 71 nM K(Er)= 78 nM K(Yb)= 100 nM K(Lu)= 128 nM false false _1837_ 0 20803 9 Not in stock false As LBTs sequences are shown in aminoacids, we had to reversely translate this sequence while taking E. coli most often used codons as reference. false Grzegorz Ścibisz BBa_K1459014_sequence 1 tatattgataccaacaacgatggctggtatgaaggcgatgaactgctggcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z