BBa_K1459015 1 BBa_K1459015 1L2Y short peptide 2014-10-12T11:00:00Z 2015-05-08T01:10:32Z http://www.rcsb.org/pdb/explore/explore.do?pdbId=1L2Y This is DNA sequence coding short peptide (PDB 1L2Y) is highly structured in water and could provide a structural foundation for small binding tags, such as we were planning to use it. false false _1837_ 0 20803 9 Not in stock false As for a peptide, we had to reversely translate the sequence, using E. coli's most often used codons. false Grzegorz Ścibisz BBa_K1459015_sequence 1 atgaacctgtatattcagtggctgaaagatggcggcccgagcagcggccgcccgccgccgagctta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z