BBa_K1460001 1 BBa_K1460001 pT7 + RBS + GST (glutathione-S-transferase)-CRS5 (metallothionein) + Ter 2014-08-13T11:00:00Z 2016-12-03T10:52:20Z T7 promoter is part BBa_I712074. RBS is from part BBa_J61101. Glutathione-S-transferase is from S. japonicum. CRS5 is a metallothionein from S. cerevisiae. Terminator is part BBa_B1006. This sequence was synthesized by GenScript in the vector pUC57 and was then transferred using traditional cloning into pSB1C3. This part serves as a functional metallothionein for heavy metal binding and conferred resistance to heavy metals when combined with a strain expressing the bacteriophage T7 polymerase. CRS5 gene is the metallothionein that binds to heavy metals and it is fused to GST for stability. false false _1839_ 24251 15649 9 In stock true Flanking the T7 promoter are two KpnI cut sites with both the T7 promoter and a SacI cut site between them. These cut sites are present for easy removal of the T7 promoter for modulation of parts with other promoters. The SacI cut site can be used as a marker for successful removal of the T7 promoter from the part. When digested with SacI, part BBa_K1460001 in pSB1C3 will yield bands of size 2166bp and 931bp. If the T7 promoter is successfully removed, when digested with SacI the plasmid will yield the linearized length of the pSB1C3+BBa_K1460001 false Eric Holmes annotation2380962 1 GST range2380962 1 92 745 annotation2380965 1 BBa_B1006 range2380965 1 989 1027 annotation2380964 1 CRS5 range2380964 1 779 988 annotation2380963 1 Linker Sequence range2380963 1 746 778 annotation2380961 1 BBa_J61101 range2380961 1 72 85 annotation2380960 1 T7 Promoter range2380960 1 13 59 BBa_K1460001_sequence 1 gtaccgagctcgtaatacgactcactatagggaatacaagctacttgttctttttgcaggtacctactagagaaagacaggaccctactagatgtcccctatactaggttattggaaaattaagggccttgtgcaacccactcgacttcttttggaatatcttgaagaaaaatatgaagagcatttgtatgagcgcgatgaaggtgataaatggcgaaacaaaaagtttgaattgggtttggagtttcccaatcttccttattatattgatggtgatgttaaattaacacagtctatggccatcatacgttatatagctgacaagcacaacatgttgggtggttgtccaaaagagcgtgcagagatttcaatgcttgaaggagcggttttggatattagatacggtgtttcgagaattgcatatagtaaagactttgaaactctcaaagttgattttcttagcaagctacctgaaatgctgaaaatgttcgaagatcgtttatgtcataaaacatatttaaatggtgatcatgtaacccatcctgacttcatgttgtatgacgctcttgatgttgttttatacatggacccaatgtgcctggatgcgttcccaaaattagtttgttttaaaaaacgtattgaagctatcccacaaattgataagtacttgaaatccagcaagtatatagcatggcctttgcagggctggcaagccacgtttggtggtggcgaccatcctccaaaatcggatctggttccgcgtggatccattcatatgatgactgtaaaaatatgtgactgtgaaggcgaatgttgtaaggactcttgtcattgtgggagcacctgccttccaagctgttctggcggtgaaaagtgcaaatgtgatcacagcaccggaagccctcaatgtaagagttgtggtgaaaaatgcaaatgcgaaaccacgtgcacttgtgaaaagagtaaatgcaattgtgaaaaatgttagaaaaaaaaaccccgcccctgacagggcggggttttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z