BBa_K1461000 1 BBa_K1461000 crRBS 2014-09-21T11:00:00Z 2015-05-08T01:10:33Z Artificial. This part is ribosome-binding site (RBS) with cis-repressor (cr) sequence. The cis-repressor sequence is placed between the transcription start site and the RBS, and its complementarity with the RBS causes a stem-loop structure to form upon transcription. This secondary structure prevents binding of the 30S ribosomal subunit to the RBS, which inhibits translation. false false _1840_ 0 18036 9 In stock true None. false Takefumi Yoshikawa annotation2384852 1 rbs range2384852 1 1 52 BBa_K1461000_sequence 1 gaactctaccattcacctcttggatttgggtattaaagaggagaaaggtacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z