BBa_K1461100 1 BBa_K1461100 miR-142-3p target binding site 2014-09-22T11:00:00Z 2015-05-08T01:10:33Z 1.Friedland, A. E., Lu, T. K., Wang, X., Shi, D., Church, G., & Collins, J. J. (2009). Synthetic gene networks that count. science, 324(5931), 1199-1202. After transcription, this cis-repressor sequence makes intramolecular hybridization with RBS and forms stem-loop stem part of which covers RBS. Therefore, when forming stem-loop, following CDS is not translated. However, if the cognate RNA which called taRNA(trans-activating RNA,BBa_k1461103) exists, this cognate RNA in turn makes hybridization with cis-repressor sequence ,undoes stem-loop and exposes RBS. false false _1840_ 0 16849 9 In stock false We designed cis-repressor sequence and taRNA sequence to make free energy of most stable formation of stem-loop < free energy of most stable taRNA-annealed RNA by using viennaRNA package. false Shunsuke Sumi annotation2386997 1 binding range2386997 1 1 25 BBa_K1461100_sequence 1 gtgtagtgtttcctactttatggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z