BBa_K1461204 1 BBa_K1461204 cr-ecf11 (+RBS, +d.term) 2014-09-24T11:00:00Z 2015-05-08T01:10:33Z Assembly. This part is a composite part of crRBS (BBa_K1461000), ecf11 (BBa_K1461005), double terminator (BBa_B0015). With promoter, mRNA which codes ecf11 will be transcripted, but not usually translated. taRNA (BBa_K1461003) activates the translation. false false _1840_ 0 18036 9 In stock false None. false Takefumi Yoshikawa component2386560 1 BBa_B0015 component2386553 1 BBa_K1461005 component2386552 1 BBa_K1461000 annotation2386552 1 BBa_K1461000 range2386552 1 1 52 annotation2386553 1 BBa_K1461005 range2386553 1 59 667 annotation2386560 1 BBa_B0015 range2386560 1 676 804 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K1461005 1 BBa_K1461005 ecf11 2014-09-23T11:00:00Z 2015-05-08T01:10:33Z Pseudomonas Syringae. This part is from Pseudomonas Syringae RpoE. ecf11 is a sigma factor which activates ecf11 promoter (BBa_K1461002) false false _1840_ 0 18036 9 In stock true None. false Takefumi Yoshikawa BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1461000 1 BBa_K1461000 crRBS 2014-09-21T11:00:00Z 2015-05-08T01:10:33Z Artificial. This part is ribosome-binding site (RBS) with cis-repressor (cr) sequence. The cis-repressor sequence is placed between the transcription start site and the RBS, and its complementarity with the RBS causes a stem-loop structure to form upon transcription. This secondary structure prevents binding of the 30S ribosomal subunit to the RBS, which inhibits translation. false false _1840_ 0 18036 9 In stock true None. false Takefumi Yoshikawa annotation2384852 1 rbs range2384852 1 1 52 BBa_K1461005_sequence 1 atgcgcattaccgcgagcctgcgcaccttttgccatctgagcaccccgcatagcgatagcaccaccagccgcctgtggattgatgaagtgaccgcggtggcgcgccagcgcgatcgcgatagctttatgcgcatttatgatcattttgcgccgcgcctgctgcgctatctgaccggcctgaacgtgccggaaggccaggcggaagaactggtgcaggaagtgctgctgaaactgtggcataaagcggaaagctttgatccgagcaaagcgagcctgggcacctggctgtttcgcattgcgcgcaacctgtatattgatagcgtgcgcaaagatcgcggctgggtgcaggtgcagaacagcctggaacagctggaacgcctggaagcgccggtggatcgcaccctggattatagccagcgccaggaacagcagctgaacagcgcgattcagaacctgccgaccgatcaggcgaaagtgctgcgcatgagctattttgaagcgctgagccatcgcgaaattagcgaacgcctggatatgccgctgggcaccgtgaaaagctgcctgcgcctggcgtttcagaaactgcgcagccgcattgaagaaagctaa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1461000_sequence 1 gaactctaccattcacctcttggatttgggtattaaagaggagaaaggtacc BBa_K1461204_sequence 1 gaactctaccattcacctcttggatttgggtattaaagaggagaaaggtacctactagatgcgcattaccgcgagcctgcgcaccttttgccatctgagcaccccgcatagcgatagcaccaccagccgcctgtggattgatgaagtgaccgcggtggcgcgccagcgcgatcgcgatagctttatgcgcatttatgatcattttgcgccgcgcctgctgcgctatctgaccggcctgaacgtgccggaaggccaggcggaagaactggtgcaggaagtgctgctgaaactgtggcataaagcggaaagctttgatccgagcaaagcgagcctgggcacctggctgtttcgcattgcgcgcaacctgtatattgatagcgtgcgcaaagatcgcggctgggtgcaggtgcagaacagcctggaacagctggaacgcctggaagcgccggtggatcgcaccctggattatagccagcgccaggaacagcagctgaacagcgcgattcagaacctgccgaccgatcaggcgaaagtgctgcgcatgagctattttgaagcgctgagccatcgcgaaattagcgaacgcctggatatgccgctgggcaccgtgaaaagctgcctgcgcctggcgtttcagaaactgcgcagccgcattgaagaaagctaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z