BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1461006 1 BBa_K1461006 anti ecf20 2014-09-23T11:00:00Z 2015-05-08T01:10:33Z Pseudomonas Fluorescens. This part is an anti-sigma factor. Anti ecf20 prevents ecf20 from activating ecf20 promoter. false false _1840_ 0 18036 9 Not in stock true None. false Takefumi Yoshikawa BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_K1461206 1 BBa_K1461206 anti ecf20 (+RBS, +d.term) 2014-09-25T11:00:00Z 2015-05-08T01:10:33Z Assembly. This part is a composite part of RBS (BBa_B0034), anti ecf20 (BBa_K1461006), and double terminator (BBa_B0015). false false _1840_ 0 18036 9 It's complicated false None. false Takefumi Yoshikawa component2386622 1 BBa_B0015 component2386615 1 BBa_K1461006 component2386614 1 BBa_B0034 annotation2386614 1 BBa_B0034 range2386614 1 1 12 annotation2386622 1 BBa_B0015 range2386622 1 459 587 annotation2386615 1 BBa_K1461006 range2386615 1 19 450 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1461006_sequence 1 atgaccccggaacgttttgtgcatctggcggatgcgtatggtgcagatctgcaacgttggccgagcgcagaacgtgcagcagcacaggcactgctggattgcggcgatgcgcaggcagtggcagcgctgcgtcaggcacattggctggatagccagctggatcgttatcaggtgccggcaccgagcccggcactggcacagcgtattattgcggcagcacaacagccgggtgcaccgttttggagccgctatgcaggttggctggcaagcctgggttgggtgggtgtgggcctgacaggcgtggcagcgggtatgctggcggtggcactgagcctgccattaagcaccagcgcagaagcactgccaagcgtgtttgatcagagcgatgcagaatttgtgctgagcattaacgcggaagaagcggaacagtaa BBa_K1461206_sequence 1 aaagaggagaaatactagatgaccccggaacgttttgtgcatctggcggatgcgtatggtgcagatctgcaacgttggccgagcgcagaacgtgcagcagcacaggcactgctggattgcggcgatgcgcaggcagtggcagcgctgcgtcaggcacattggctggatagccagctggatcgttatcaggtgccggcaccgagcccggcactggcacagcgtattattgcggcagcacaacagccgggtgcaccgttttggagccgctatgcaggttggctggcaagcctgggttgggtgggtgtgggcctgacaggcgtggcagcgggtatgctggcggtggcactgagcctgccattaagcaccagcgcagaagcactgccaagcgtgtttgatcagagcgatgcagaatttgtgctgagcattaacgcggaagaagcggaacagtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z