BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K1461004 1 BBa_K1461004 ecf20 2014-09-23T11:00:00Z 2015-05-08T01:10:33Z Pseudomonas Fluorescens. This part is from Pseudomonas Fluorescens sigma 70 family. ecf20 is a sigma factor which activates ecf20 promoter (BBa_K1461001). false false _1840_ 0 18036 9 In stock true None. false Takefumi Yoshikawa BBa_K1461221 1 BBa_K1461221 ecf20 generator (positive feedback) 2014-09-26T11:00:00Z 2015-05-08T01:10:33Z Assembly. This generator codes ecf20 (BBa_K1461004), under ecf20 promoter (BBa_K1461001). This positive feedback in our &#963;-Re Counter project enables the chassis, E.coli, to remain memory. false false _1840_ 0 18036 9 It's complicated false None. false Takefumi Yoshikawa component2387410 1 BBa_B0034 component2387408 1 BBa_K1461001 component2387411 1 BBa_K1461004 component2387418 1 BBa_B0015 annotation2387418 1 BBa_B0015 range2387418 1 697 825 annotation2387408 1 BBa_K1461001 range2387408 1 1 80 annotation2387411 1 BBa_K1461004 range2387411 1 107 688 annotation2387410 1 BBa_B0034 range2387410 1 89 100 BBa_K1461001 1 BBa_K1461001 ecf20 promoter 2014-09-23T11:00:00Z 2015-05-08T01:10:33Z Pseudomonas Fluorescens. This part is from Pseudomonas Fluorescens sigma 70 family. ecf20 (BBa_K1461004) activates the expression of the downstream genes of this promoter. false false _1840_ 0 18036 9 In stock true None. false Takefumi Yoshikawa BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1461221_sequence 1 gcgcggataaaaatttcatttgcccgcgacggattccccgcccatctatcgttgaacccatcagctgcgttcatcagcgatactagagaaagaggagaaatactagatgaacgaaaccgatccggatctggaactgctgaaacgtattggcaacaacgatgcacaggcggtgaaagaaatggtgacccgcaaactgccgcgcctgctggcgctggcgagccgtctgctgggcgatgcggatgaagcgcgcgatattgcgcaggaaagctttctgcgcatttggaaacaggcagcgagctggcgcagcgaacaggcgcgctttgatacctggctgcatcgcgtggcgctgaacctgtgctatgatcgcctgcgccgtcgtaaagaacatgtgccggtggatagcgaacatgcgtgcgaagcgctggatacccgcccggcgccggatgaacagctggaagcgagcgcgcagagccgtcgcatggcgcaggcactggatcagctgccggatcgtcagcgcgaagcgattgtgctgcaatattatcaggaactgagcaacaccgaagcagcggcactgatgcagattagcgtggaagcgctggaaagcctgctgagccgcgcacgtcgcaacctgcgcagccatctggcggaagcgccgggtgcggatctgagcggccgtcgcaaaccgtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_K1461004_sequence 1 atgaacgaaaccgatccggatctggaactgctgaaacgtattggcaacaacgatgcacaggcggtgaaagaaatggtgacccgcaaactgccgcgcctgctggcgctggcgagccgtctgctgggcgatgcggatgaagcgcgcgatattgcgcaggaaagctttctgcgcatttggaaacaggcagcgagctggcgcagcgaacaggcgcgctttgatacctggctgcatcgcgtggcgctgaacctgtgctatgatcgcctgcgccgtcgtaaagaacatgtgccggtggatagcgaacatgcgtgcgaagcgctggatacccgcccggcgccggatgaacagctggaagcgagcgcgcagagccgtcgcatggcgcaggcactggatcagctgccggatcgtcagcgcgaagcgattgtgctgcaatattatcaggaactgagcaacaccgaagcagcggcactgatgcagattagcgtggaagcgctggaaagcctgctgagccgcgcacgtcgcaacctgcgcagccatctggcggaagcgccgggtgcggatctgagcggccgtcgcaaaccgtaa BBa_K1461001_sequence 1 gcgcggataaaaatttcatttgcccgcgacggattccccgcccatctatcgttgaacccatcagctgcgttcatcagcga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z