BBa_K1462000 1 CoxVI CoxVI 2014-10-13T11:00:00Z 2015-05-08T01:10:34Z CoxVI is obtained from Saccharomyces cerevisiae's genome. CoxVI is short for the subunit VI of the yeast cytochrome c oxidase, a N-terminal signal peptide to mitochondrial matrix. false false _1841_ 0 21369 9 Not in stock true 1 false Chuyao Fan BBa_K1462000_sequence 1 atgttatcaagggccatattcagaaatccagttataaatagaactttattgagagccagacctggtgcttatcatgcaactagattgactaaaaatacgtttattcaaagtaggaagtat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z