BBa_K1462010 1 BBa_K1462010 coxIV 2014-10-13T11:00:00Z 2015-05-08T01:10:34Z Saccharomyces cerevisiae genome CoxVI is the N-terminal mitochondrial localization signal from subunit IV of the yeast cytochrome c oxidase. false false _1841_ 0 21369 9 Not in stock false 1 false Chuyao Fan BBa_K1462010_sequence 1 atgctttcactacgtcaatctataagatttttcaagccagccacaagaactttgtgtagctctagatatctgctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z