BBa_K1462940 1 BBa_K1462940 Erv25p 2014-10-14T11:00:00Z 2015-05-08T01:10:36Z Erv25p that was discovered on ER-derived transport vesicles Erv25p is a single membrane spanning segment derived from yeast, and a 12-amino acid COOH-terminal sequence exposed to the cytoplasm. false false _1841_ 0 21372 9 Not in stock false Find a most appropriate sequence be our leading peptide false LinZhou Li,YaRan Zhao BBa_K1462940_sequence 1 atgcaggtgttacagttatggttgacaactttgatctctttggtggtggcagtgcaggga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z