BBa_K1463001 1 BBa_K1463001 Recombinase Switch With GFP 2014-10-14T11:00:00Z 2015-05-08T01:10:36Z Composite biobrick consisting of attP, reversed BBa_J23100 promoter, forward facing BBa_B0010 terminator, PhiC31 attB site and the BBa_E0040 GFP gene with a strong BBa_B0034 ribosome binding site. PhiC31-based recombinase switch with GFP to the right and a leftward facing promoter so that PhiC31 integrase switches on GFP expression. false false _1842_ 0 20827 9 Not in stock false The promoter had to face leftwards, the attP and attB sites had to be far enough apart to recombine efficiently and be in head-to-head (inverted repeat) orientation. false iGEM14_Glasgow component2420007 1 BBa_K1463030 component2420008 1 BBa_K1463501 component2420013 1 BBa_B0034 component2420015 1 BBa_E0040 component2420009 1 BBa_B0010 component2420006 1 BBa_K1463040 component2420011 1 BBa_K1463041 annotation2420015 1 BBa_E0040 range2420015 1 294 1013 annotation2420011 1 BBa_K1463041 range2420011 1 213 267 annotation2420007 1 BBa_K1463030 range2420007 1 63 73 annotation2420009 1 BBa_B0010 range2420009 1 125 204 annotation2420008 1 BBa_K1463501 range2420008 1 82 116 annotation2420006 1 BBa_K1463040 range2420006 1 1 54 annotation2420013 1 BBa_B0034 range2420013 1 276 287 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1463041 1 attB Reversed PhiC31 attB site 2014-08-13T11:00:00Z 2015-05-08T01:10:37Z Sythesised by IDT Technologies from a given sequence. PhiC31 attB site false false _1842_ 0 23036 9 Not in stock false ... false Beth Greig BBa_K1463501 1 rev promot J23100 promoter in reverse 2014-08-11T11:00:00Z 2015-05-08T01:10:37Z Synthesised by IDT Technologies from a given sequence. Did not come from any genomic sequence. J23100 Constitutive promoter reversed false false _1842_ 0 23036 9 Not in stock false No special design considerations other than ensuring the promoter was in reverse. false Beth Greig BBa_K1463030 1 spacer Switch Nucleotide Spacer 2014-08-13T11:00:00Z 2015-05-08T01:10:36Z Synthesised by IDT Technologies from a given sequence. Sequence is not from genome. BamHI and HindIII sites contained when combined with scar sequences in switch, part BBa_K1463000. This spacer is required for the function of this larger part. false false _1842_ 0 23036 9 Not in stock false Created this part with 2 restriction sites when combined with scar sites in larger composite part. false Beth Greig BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1463040 1 attP PhiC31 attP site 2014-08-13T11:00:00Z 2015-05-08T01:10:37Z Synthesised by IDT technologies from a given sequence. PhiC31 attP site false false _1842_ 0 23036 9 Not in stock false ... false Beth Greig BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K1463040_sequence 1 gagtagtgccccaactggggtaacctttgagttctctcagttgggggcgtaggg BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1463501_sequence 1 gctagcactgtacctaggactgagctagccgtcaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K1463030_sequence 1 gatccgaagct BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K1463041_sequence 1 aggtggagtacgcgcccggggagcccaagggcacgccctggcacccgcaccgcgg BBa_K1463001_sequence 1 gagtagtgccccaactggggtaacctttgagttctctcagttgggggcgtagggtactagaggatccgaagcttactagaggctagcactgtacctaggactgagctagccgtcaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagaggtggagtacgcgcccggggagcccaagggcacgccctggcacccgcaccgcggtactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z