BBa_K1463031 1 BBa_K1463031 Prefix and extra nucleotides for switch 2014-09-08T11:00:00Z 2015-05-08T01:10:37Z Synthesised by IDT from a given sequence. Contains restriction sites false false _1842_ 0 23036 9 Not in stock false Switch required extra nucleotides and restriction site added to check function of switch. false Beth Greig BBa_K1463031_sequence 1 aacgtctagatcgtaggtacgtacagatctgaattcgcggccgcttctagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z