BBa_K1463032 1 BBa_K1463032 Suffix and extra nucleotides for recombinase switch function 2014-09-08T11:00:00Z 2015-05-08T01:10:37Z Synthesised by IDT from a given sequence. This part contains the suffix sequence and also extra nucleotides to allow for the function of the recombinase switch. false false _1842_ 0 23036 9 Not in stock false Extra nucleotides contain restriction site to check for switch function. false Beth Greig BBa_K1463032_sequence 1 tactagtagcggccgctgcagggtaccaatcgtgcagtcagtacgtagcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z