BBa_K1463225 1 BBa_K1463225 GvpC and B0032 2014-08-13T11:00:00Z 2015-05-08T01:10:37Z Parts were from the 2014 distribution. GvpC gene is from the genome of Planktothrix rubescens. Gas vesicle protein gene C and B0032, a medium RBS with an efficiency of 0.3. false false _1842_ 0 23036 9 In stock false No specific design considerations. false Beth Greig component2380913 1 BBa_B0032 component2380915 1 BBa_K737017 annotation2380915 1 BBa_K737017 range2380915 1 20 523 annotation2380913 1 BBa_B0032 range2380913 1 1 13 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_K737017 1 BBa_K737017 This part conteins gvpC-20psi protein 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z Yes Released HQ 2013 This part conteins gvpA protein's coding sequence. This gene from Planktothrix rubescens can be succesfully expressed in E. coli. The gvpA's expression have been examined by another part " J23106+B0034+gvpA+B0015". (Since it was ligated on cloning vector pSB4A5, we didn't register this part. The gvpA protein conteins a typical domain of the superfamily 'Gas vesicle'(NCBI CDD cl02594). This gene is quiet conserved in most gvp's polycistron. According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false false _986_ 0 14291 9 In stock false The gvpA protein conteins a typical domain of the superfamily 'Gas vesicle'(NCBI CDD cl02594). This gene is quiet conserved in most gvp's polycistron. According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false Jiaheng Li BBa_K737017_sequence 1 atggctttaaaagacaagtggcaacaggatcgtatcggacgccaacagggagttcaagaacggcaacagcaagttcaaaccaccctatccctctggcaacaagagcgccaaaatcaggcttctgaatttcgggaagacctagaatatcgggtaacggatctgttagctaattatcagaaacagcgcctagaagctagggaaactttacttgaggacttagctatttttcgtcaaaccctatatcgggaagtcgaagaatatttaggggagttagatattctgcaccagcaaatggccgcacaattacaacaacaactccaacagagtcggacggaaagaaaagacgctgttcagaagttattcgaggatttaggggtatttcgcgccgaactacaagactatcacctcaaacttcaacagacagtttgggggagttcccaccgaaaaccgcgaaaagcgattaccccgcaacgctctattccatcgcgtttatattcctgttaa BBa_B0032_sequence 1 tcacacaggaaag BBa_K1463225_sequence 1 tcacacaggaaagtactagatggctttaaaagacaagtggcaacaggatcgtatcggacgccaacagggagttcaagaacggcaacagcaagttcaaaccaccctatccctctggcaacaagagcgccaaaatcaggcttctgaatttcgggaagacctagaatatcgggtaacggatctgttagctaattatcagaaacagcgcctagaagctagggaaactttacttgaggacttagctatttttcgtcaaaccctatatcgggaagtcgaagaatatttaggggagttagatattctgcaccagcaaatggccgcacaattacaacaacaactccaacagagtcggacggaaagaaaagacgctgttcagaagttattcgaggatttaggggtatttcgcgccgaactacaagactatcacctcaaacttcaacagacagtttgggggagttcccaccgaaaaccgcgaaaagcgattaccccgcaacgctctattccatcgcgtttatattcctgttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z