BBa_K1463100 1 BBa_K1463100 GvpA, K737016, RBS 2014-10-03T11:00:00Z 2015-05-08T01:10:37Z ... RBS designed for GvpA, part number K737016. false false _1842_ 0 23036 9 Not in stock false ... false Beth Greig BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_K1463350 1 BBa_K1463350 K1463100 RBS + GvpA + B0032 RBS + GvpC 2014-10-03T11:00:00Z 2015-05-08T01:10:37Z ... K1463100 RBS + GvpA, K737016 + B0032 RBS + GvpC, K737017 false false _1842_ 0 23036 9 In stock false ... false Beth Greig component2393617 1 BBa_B0032 component2393619 1 BBa_K737017 component2393614 1 BBa_K1463100 component2393615 1 BBa_K737016 annotation2393617 1 BBa_B0032 range2393617 1 242 254 annotation2393615 1 BBa_K737016 range2393615 1 15 233 annotation2393619 1 BBa_K737017 range2393619 1 261 764 annotation2393614 1 BBa_K1463100 range2393614 1 1 8 BBa_K737017 1 BBa_K737017 This part conteins gvpC-20psi protein 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z Yes Released HQ 2013 This part conteins gvpA protein's coding sequence. This gene from Planktothrix rubescens can be succesfully expressed in E. coli. The gvpA's expression have been examined by another part " J23106+B0034+gvpA+B0015". (Since it was ligated on cloning vector pSB4A5, we didn't register this part. The gvpA protein conteins a typical domain of the superfamily 'Gas vesicle'(NCBI CDD cl02594). This gene is quiet conserved in most gvp's polycistron. According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false false _986_ 0 14291 9 In stock false The gvpA protein conteins a typical domain of the superfamily 'Gas vesicle'(NCBI CDD cl02594). This gene is quiet conserved in most gvp's polycistron. According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false Jiaheng Li BBa_K737016 1 BBa_K737016 This part conteins gvpA protein's coding sequence. 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z Yes. This part conteins gvpA protein's coding sequence. This gene from Planktothrix rubescens can be succesfully expressed in E. coli. The gvpA's expression have been examined by another part " J23106+B0034+gvpA+B0015". (Since it was ligated on cloning vector pSB4A5, we didn't register this part. The gvpA protein conteins a typical domain of the superfamily 'Gas vesicle'(NCBI CDD cl02594). This gene is quiet conserved in most gvp's polycistron. According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false false _986_ 0 14291 9 In stock false According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false Jiaheng Li BBa_K737017_sequence 1 atggctttaaaagacaagtggcaacaggatcgtatcggacgccaacagggagttcaagaacggcaacagcaagttcaaaccaccctatccctctggcaacaagagcgccaaaatcaggcttctgaatttcgggaagacctagaatatcgggtaacggatctgttagctaattatcagaaacagcgcctagaagctagggaaactttacttgaggacttagctatttttcgtcaaaccctatatcgggaagtcgaagaatatttaggggagttagatattctgcaccagcaaatggccgcacaattacaacaacaactccaacagagtcggacggaaagaaaagacgctgttcagaagttattcgaggatttaggggtatttcgcgccgaactacaagactatcacctcaaacttcaacagacagtttgggggagttcccaccgaaaaccgcgaaaagcgattaccccgcaacgctctattccatcgcgtttatattcctgttaa BBa_K1463350_sequence 1 aaagagaatactagatggccgttgaaaaagtaaactcatcctccagtctggccgaagttatcgatcggatcttagataaaggcattgtgattgacgcttgggtacgggtttccctcgttggaatcgagcttctatccatagaagcaagaatcgtgatcgcttctgttgaaacctatctcaagtacgcagaagccgttggtttaaccgcacaggcggctgttccttcggtctaatactagagtcacacaggaaagtactagatggctttaaaagacaagtggcaacaggatcgtatcggacgccaacagggagttcaagaacggcaacagcaagttcaaaccaccctatccctctggcaacaagagcgccaaaatcaggcttctgaatttcgggaagacctagaatatcgggtaacggatctgttagctaattatcagaaacagcgcctagaagctagggaaactttacttgaggacttagctatttttcgtcaaaccctatatcgggaagtcgaagaatatttaggggagttagatattctgcaccagcaaatggccgcacaattacaacaacaactccaacagagtcggacggaaagaaaagacgctgttcagaagttattcgaggatttaggggtatttcgcgccgaactacaagactatcacctcaaacttcaacagacagtttgggggagttcccaccgaaaaccgcgaaaagcgattaccccgcaacgctctattccatcgcgtttatattcctgttaa BBa_K737016_sequence 1 atggccgttgaaaaagtaaactcatcctccagtctggccgaagttatcgatcggatcttagataaaggcattgtgattgacgcttgggtacgggtttccctcgttggaatcgagcttctatccatagaagcaagaatcgtgatcgcttctgttgaaacctatctcaagtacgcagaagccgttggtttaaccgcacaggcggctgttccttcggtctaa BBa_B0032_sequence 1 tcacacaggaaag BBa_K1463100_sequence 1 aaagagaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z