BBa_K1463501 1 rev promot J23100 promoter in reverse 2014-08-11T11:00:00Z 2015-05-08T01:10:37Z Synthesised by IDT Technologies from a given sequence. Did not come from any genomic sequence. J23100 Constitutive promoter reversed false false _1842_ 0 23036 9 Not in stock false No special design considerations other than ensuring the promoter was in reverse. false Beth Greig BBa_K1463501_sequence 1 gctagcactgtacctaggactgagctagccgtcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z