BBa_K1467200 1 BBa_K1467200 RFP coding device - Golden Gate Module Flipper 2014-09-23T11:00:00Z 2015-05-08T01:10:38Z BBa_J04450 This part is a "GoldenGate Flipper" that can be used to convert CDS1 (coding sequence) modules from the GoldenGate MoClo Assembly Standard into standard BioBricks. Flanking the RFP is an inverted pair of BsaI recognition sequences either side of the original RFP reporter part. The flipper reaction is a one-pot, one-step, digestion-ligation GoldenGate cloning reaction. The image below shows the sequences inserted (in orange) between the RFP and the BioBrick prefix and suffix that enable the flipper to accept MoClo CDS1 parts, which begin AATG and end GGCT, in a one-step digestion-ligation Golden Gate cloning reaction. [[Image:cdsflipper.jpg|600px|]] The colonies containing this part are clearly red in color under natural light after about 18 hours. Smaller colonies are visibly red under UV. The RFP part does not contain a degradation tag and the RBS is strong.When cloning is successful the colonies become white as the RFP sequence is replaced by the new part. After the reaction is complete, no part of the BsaI recognition sequence will remain between the BioBrick suffix and the part. The colonies containing this part are clearly red in color under natural light after about 18 hours. Smaller colonies are visibly red under UV. The RFP part does not contain a degradation tag and the RBS is strong.When cloning is successful the colonies become white as the RFP sequence is replaced by the new part. After the reaction is complete, no part of the BsaI recognition sequence will remain between the BioBrick suffix and the part. false false _1846_ 0 20866 9 In stock true The sequences inserted between the RFP and the BioBrick prefix and suffix include a pair on inverted BsaI recognition sites to enable the flipper to accept MoClo CDS1 parts, which begin AATG and end GGCT, in a one-step digestion-ligation Golden Gate cloning reaction. false Jessica Gray, Cara Deal BBa_K1467200_sequence 1 aatgtgagaccgcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataggtctcagcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z