BBa_K1467300 1 BBa_K1467300 Golden Gate Module Flipper for 3'UTR+Terminator parts 2014-09-23T11:00:00Z 2015-09-09T04:30:34Z BBa_J04450 This part is a "GoldenGate Flipper" that can be used to convert 3U+Ter (3' untranslated region and terminator) modules from the GoldenGate MoClo Assembly Standard into standard BioBricks. Flanking the RFP is an inverted pair of BsaI recognition sequences either side of the original RFP reporter part. The flipper reaction is a one-pot, one-step, digestion-ligation GoldenGate cloning reaction. The image below shows the sequences inserted (in orange) between the RFP and the BioBrick prefix and suffix that enable the flipper to accept MoClo CDS1 parts, which begin GCTT and end CGCT, in a one-step digestion-ligation Golden Gate cloning reaction. [[Image:terflipper.jpg|600px|]] The colonies containing this part are clearly red in color under natural light after about 18 hours. Smaller colonies are visibly red under UV. The RFP part does not contain a degradation tag and the RBS is strong.When cloning is successful the colonies become white as the RFP sequence is replaced by the new part. After the reaction is complete, no part of the BsaI recognition sequence will remain between the BioBrick suffix and the part. The colonies containing this part are clearly red in color under natural light after about 18 hours. Smaller colonies are visibly red under UV. The RFP part does not contain a degradation tag and the RBS is strong.When cloning is successful the colonies become white as the RFP sequence is replaced by the new part. After the reaction is complete, no part of the BsaI recognition sequence will remain between the BioBrick suffix and the part. false false _1846_ 20866 20866 9 In stock false The sequences inserted between the RFP and the BioBrick prefix and suffix include a pair of inverted BsaI recognition sequences that enable the flipper to accept MoClo 3U+Ter parts, which begin GCTT and end CGCT, in a one-step digestion-ligation Golden Gate cloning reaction. false Cara Deal, Jessica Gray BBa_K1467300_sequence 1 gctttgagaccgcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataggtctcacgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z