BBa_K1467400 1 BBa_K1467400 RFP coding device - Golden Gate Module Flipper 2014-09-23T11:00:00Z 2015-05-08T01:10:38Z BBa_J04450 This part is a "GoldenGate Flipper" that can be used to assemble complete transcriptional units from GoldenGate MoClo Standard Parts. The final assembly will be a standard BioBrick. Flanking the RFP is an inverted pair of BsaI recognition sequences either side of the original RFP reporter part. The image below shows the sequences inserted (in orange) between the RFP and the BioBrick prefix and suffix that enable the flipper to accept the parallel assembly of multiple MoClo parts in a one-step digestion-ligation Golden Gate cloning reaction. The colonies containing this part are clearly red in color under natural light after about 18 hours. Smaller colonies are visibly red under UV. The RFP part does not contain a degradation tag and the RBS is strong.When cloning is successful the colonies become white as the RFP sequence is replaced by the new part. After the reaction is complete, no part of the BsaI recognition sequence will remain between the BioBrick suffix and the part. The colonies containing this part are clearly red in color under natural light after about 18 hours. Smaller colonies are visibly red under UV. The RFP part does not contain a degradation tag and the RBS is strong.When cloning is successful the colonies become white as the RFP sequence is replaced by the new part. After the reaction is complete, no part of the BsaI recognition sequence will remain between the BioBrick suffix and the part. false false _1846_ 0 20866 9 In stock false The sequences inserted (in orange) between the RFP and the BioBrick prefix and suffix include an inverted pair of BsaI recognition sequences that release the RFP to provide 4bp 5' overhangs compatible with the GoldenGate MoCloassembly standard, directly adjacent to the BioBrick suffix. false Cara Deal, Jessica Gray BBa_K1467400_sequence 1 ggagtgagaccgcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataggtctcacgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z