BBa_K1470001 1 BBa_K1470001 puromycin N-acetyl-transferase 2014-09-30T11:00:00Z 2015-05-08T01:10:38Z puromycin N-acetyl-transferase is a protein of Streptomyces alboniger. We got thi spart from iGEM Freiburg 2013 Puromycin is an antibodic derived from Streptomyces alboniger. The substance affects the cell both in protein translation and mitochondrial protein import. Due to this, it's toxic to many organisms such as bacteria, Trypanosoma and humans. A small part of its structure resembles to aminoacetylated tRNA and is recognized by ribosomes. the nascent chain containing puromycin leads to a translational stop. Streptomyces alboniger protects itself from puromycin with a acetyl transferase. It uses acetyl-CoA to bind the the acetyl group with the amino group. In this state puromycin cannot be recognized by the ribosom anymore. This enzyme is a great tool for selecting stable eucaryotic cell lines. Because of the blocked protein biosynthesis nearly over 99 % of unimfected cells will be dead within tows days. false false _1849_ 0 20909 9 It's complicated false We had no design consideration, because the sequence contains no restriction sites at all. false Pascal Sartor BBa_K1470001_sequence 1 atgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgcggccgtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggagtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z