BBa_K1471000 1 BBa_K1471000 MerE. 2014-10-07T11:00:00Z 2015-07-22T02:39:55Z Bacterial operon mer. For mercury bioaccumulation. false false _1850_ 4206 16464 9 It's complicated false We have to optimizes its codons in Arabidopsis Thaliana and removed the restriction sites for EcoR1, Xba1, Spe1 and Pst1. false Juan No?? Hern??ndez Salazar BBa_K1471011 1 BBa_K1471011 RBS (Arabidopsis Thaliana). 2014-10-13T11:00:00Z 2015-05-08T01:10:39Z Arabidopsis thaliana genome sequence. The initiation of protein biosynthesis is a major determinant of the efficiency of gene expression at the translational level. It is known that the nucleotide sequences around the AUG translation initiation codon act as an important signal to trigger the initiation of the translation event. (Kozak, 1987) false false _1850_ 0 16464 9 Not in stock false We had to discuss what was the best option to enhance the expression efficiency of our proteins of interest to bio-remediate heavy metals, as mercury. false Juan Noe Hernandez Salazar annotation2419434 1 Kozak Sequence. range2419434 1 1 11 annotation2419570 1 Receptor codon. range2419570 1 8 10 annotation2419569 1 Ribosome binds to 5' end. range2419569 1 1 1 BBa_K1471002 1 BBa_K1471002 RBS with MerE. 2014-10-07T11:00:00Z 2015-05-08T01:10:39Z We have to optimized its codons in Arabidopsis Thaliana and removed the restriction sites for EcoR1, Xba1, Spe1 and Pst1. This part contains a RBS (Ribosome Binding Site) for Yeast followed by a coding sequence named MerE from the bacterial operon mer. false false _1850_ 0 16464 9 It's complicated false The RBS came from an Eukaryotic cell and MerE came from bacterial operon mer for mercury resistance. false Juan Noe Hernandez Salazar component2419407 1 BBa_K1471000 component2419406 1 BBa_K1471011 annotation2419407 1 BBa_K1471000 range2419407 1 18 197 annotation2419406 1 BBa_K1471011 range2419406 1 1 11 BBa_K1471000_sequence 1 atgcgggccaagtccgctattttctcacgcacatcgcttagtctatgctctgcaagactactcgcgtccagtcagtgggttccgtcttcctccaggaatagctcggcgatctcgtcacgcttaaatcctagtaggtgcgcagactttacaaactttacccggacaacatcagcttctccc BBa_K1471002_sequence 1 ttcgttaccgctactagatgcgggccaagtccgctattttctcacgcacatcgcttagtctatgctctgcaagactactcgcgtccagtcagtgggttccgtcttcctccaggaatagctcggcgatctcgtcacgcttaaatcctagtaggtgcgcagactttacaaactttacccggacaacatcagcttctccc BBa_K1471011_sequence 1 aagcaatggcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z