BBa_K678019 1 BGH pA BGH poly A, mammalian terminator 2011-09-03T11:00:00Z 2015-05-08T01:13:04Z From plasmid pcDNA3.1 from Invitrogen BGH poly A, terminator for use in mammalian cells false false _882_ 0 8341 9 It's complicated false Compatible with the Plug'n'Play assembly standard false DTU-Denmark-2 annotation2127352 1 Linker 4 range2127352 1 1 8 annotation2127353 1 BGH range2127353 1 9 233 BBa_K1471004 1 BBa_K1471004 NLS with PolyA. 2014-10-07T11:00:00Z 2015-05-08T01:10:39Z Previous iGEM Competitions. We have to optimized its codons in Arabidopsis Thaliana and removed the restriction sites for EcoR1, Xba1, Spe1 and Pst1. false false _1850_ 0 16464 9 It's complicated false We had to use this fragments without the use of gel electrophoresis because the small length of the sequences. false Juan Noe Hernandez Salazar component2404337 1 BBa_K678019 component2404334 1 BBa_K404153 annotation2404334 1 BBa_K404153 range2404334 1 1 21 annotation2404337 1 BBa_K678019 range2404337 1 30 262 BBa_K404153 1 BBa_K404153 [AAV2]-NLS 2010-10-10T11:00:00Z 2015-05-08T01:12:24Z x x false false _508_ 0 6733 9 In stock false x false Freiburg Bioware 2010 annotation2094093 1 NLS range2094093 1 1 21 BBa_K678019_sequence 1 attccgatctgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatgg BBa_K1471004_sequence 1 cctgcaagaaaaagattgaattactagagattccgatctgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatgg BBa_K404153_sequence 1 cctgcaagaaaaagattgaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z