BBa_K1471005 1 BBa_K1471005 AGS (Linker) - VP16 (Activation domain). 2014-10-07T11:00:00Z 2015-05-08T01:10:39Z sdgsgsdgsdg wgsdg false false _1850_ 0 16614 9 It's complicated false sgvgsdf false Jaime Antonio del Castillo Nu??ez component2404170 1 BBa_K1150013 component2404172 1 BBa_K1150001 annotation2404170 1 BBa_K1150013 range2404170 1 1 9 annotation2404172 1 BBa_K1150001 range2404172 1 18 389 BBa_K1471008 1 BBa_K1471008 RBS - PhyB - AGS - VP16. 2014-10-07T11:00:00Z 2015-05-08T01:10:39Z dfaksdjfas Laskfjasdfas false false _1850_ 0 16464 9 It's complicated false asdflkzcuia false Juan Noe Hernandez Salazar component2419422 1 BBa_K1471005 component2419417 1 BBa_K1471011 annotation2419422 1 BBa_K1471005 range2419422 1 20 408 annotation2419417 1 BBa_K1471011 range2419417 1 1 11 BBa_K1471011 1 BBa_K1471011 RBS (Arabidopsis Thaliana). 2014-10-13T11:00:00Z 2015-05-08T01:10:39Z Arabidopsis thaliana genome sequence. The initiation of protein biosynthesis is a major determinant of the efficiency of gene expression at the translational level. It is known that the nucleotide sequences around the AUG translation initiation codon act as an important signal to trigger the initiation of the translation event. (Kozak, 1987) false false _1850_ 0 16464 9 Not in stock false We had to discuss what was the best option to enhance the expression efficiency of our proteins of interest to bio-remediate heavy metals, as mercury. false Juan Noe Hernandez Salazar annotation2419569 1 Ribosome binds to 5' end. range2419569 1 1 1 annotation2419434 1 Kozak Sequence. range2419434 1 1 11 annotation2419570 1 Receptor codon. range2419570 1 8 10 BBa_K1150013 1 BBa_K1150013 AGS Linker 2013-09-15T11:00:00Z 2015-05-08T01:09:27Z ... ... false false _1462_ 0 16627 9 In stock false ... false Freiburg 2013 annotation2347934 1 AGS Linker range2347934 1 1 9 BBa_K1150001 1 BBa_K1150001 VP16 2013-09-15T11:00:00Z 2015-05-08T01:09:27Z ... VP16 is ... false false _1462_ 0 16627 9 In stock false ... false Freiburg 2013 annotation2347617 1 VP16 range2347617 1 1 372 BBa_K1150001_sequence 1 gcgcgtacgaaaaacaattacgggtctaccatcgagggcctgctcgatctcccggacgacgacgcccccgaagaggcggggctggcggctccgcgcctgtcctttctccccgcgggacacacgcgcagactgtcgacggcccccccgaccgatgtcagcctgggggacgagctccacttagacggcgaggacgtggcgatggcgcatgccgacgcgctagacgatttcgatctggacatgttgggggacggggattccccgggtccgggatttaccccccacgactccgccccctacggcgctctggatatggccgacttcgagtttgagcagatgtttaccgatgcccttggaattgacgagtacggtggg BBa_K1471008_sequence 1 ttcgttaccgctactagaggcaggctcctactagaggcgcgtacgaaaaacaattacgggtctaccatcgagggcctgctcgatctcccggacgacgacgcccccgaagaggcggggctggcggctccgcgcctgtcctttctccccgcgggacacacgcgcagactgtcgacggcccccccgaccgatgtcagcctgggggacgagctccacttagacggcgaggacgtggcgatggcgcatgccgacgcgctagacgatttcgatctggacatgttgggggacggggattccccgggtccgggatttaccccccacgactccgccccctacggcgctctggatatggccgacttcgagtttgagcagatgtttaccgatgcccttggaattgacgagtacggtggg BBa_K1471005_sequence 1 gcaggctcctactagaggcgcgtacgaaaaacaattacgggtctaccatcgagggcctgctcgatctcccggacgacgacgcccccgaagaggcggggctggcggctccgcgcctgtcctttctccccgcgggacacacgcgcagactgtcgacggcccccccgaccgatgtcagcctgggggacgagctccacttagacggcgaggacgtggcgatggcgcatgccgacgcgctagacgatttcgatctggacatgttgggggacggggattccccgggtccgggatttaccccccacgactccgccccctacggcgctctggatatggccgacttcgagtttgagcagatgtttaccgatgcccttggaattgacgagtacggtggg BBa_K1150013_sequence 1 gcaggctcc BBa_K1471011_sequence 1 aagcaatggcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z