BBa_K1472601 1 BBa_K1472601 Leaderless thioesterase 2014-09-15T11:00:00Z 2015-05-08T01:10:39Z The genome sequence of Escherichia coli K-12 substr. W3110 is available in GenBank at http://www.ncbi.nlm.nih.gov/gene/12930860. We have cloned a modified thioesterase gene, ???tesA, which codes for an E. coli thioesterase protein that lacks the N-terminal 26-amino acid signal peptide sequence, and is named here as ???leaderless TesA??? or ???TesA. The ???TesA protein is expected to be expressed exclusively in the cytosol of E. coli to catalyze the conversion of fatty acyl-ACP (acyl carrier protein) or fatty acyl-CoA to free fatty acids (Figure 1). ???TesA is predicted to enhance free fatty acid production in the genetically-modified E. coli strain. false false _1851_ 0 22977 9 In stock false N/A false Lo Hiu Fung, Lau Tsz Kit, Chu Lok Ting, Wu Chun Ting annotation2383718 1 'tesA range2383718 1 1 549 BBa_K1472601_sequence 1 atggacacgttattgattctgggtgatagcctgagcgccgggtatcgaatgtctgccagcgcggcctggcctgccttgttgaatgataagtggcagagtaaaacgtcggtagttaatgccagcatcagcggcgacacctcgcaacaaggactggcgcgccttccggctctgctgaaacagcatcagccgcgttgggtgctggttgaactgggcggcaatgacggtttgcgtggttttcagccacagcaaaccgagcaaacgctgcgccagattttgcaggatgtcaaagccgccaacgctgaaccattgttaatgcaaatacgtctgcctgcaaactatggtcgccgttataatgaagcctttagcgccatttaccccaaactcgccaaagagtttgatgttccgctgctgcccttttttatggaagaggtctacctcaagccacaatggatgcaggatgacggtattcatcccaaccgcgacgcccagccgtttattgccgactggatggcgaagcagttgcagcctttagtaaatcatgactcataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z