BBa_K1473001 1 BBa_K1473001 gRNA 1 2014-09-11T11:00:00Z 2015-05-08T01:10:39Z From ordering. This part is a 20 bp of gRNA for CRISPR system. It targets Nalidixic acid resistance gene. false false _1852_ 0 20914 9 Not in stock false No false Shan, Zhe BBa_K1473001_sequence 1 aaagcagaagagaacaaatcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z