BBa_K1473004 1 BBa_K1473004 gRNA 4 2014-09-16T11:00:00Z 2015-05-08T01:10:39Z It is designed from nalR gene from bacteria JM101's genome sequence. The design is under basic rules of gRNA design: 20bp upstream from PAM site. This part is a 22 bp of gRNA (including PAM site) for CRISPR system. It targets Nalidixic acid resistance gene. false false _1852_ 0 20914 9 It's complicated false To make sure our design is valid for CRISPR system. We screened raw result (all 20bp sequences upstream to PAM sites) by calculating it's GC account and testing its specificity by bioinformatic tools. false Shan, Zhe BBa_K1473004_sequence 1 agagaacaaatcggacagctgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z