BBa_K1473020 1 BBa_K1473020 gRNA for tetR 4 2014-09-30T11:00:00Z 2015-05-08T01:10:39Z From tetracycline resistance gene sequence of bacterial plasmid pO26-L. This part is a 22 bp of gRNA for CRISPR system. It targets tetracycline resistance gene. false false _1852_ 0 20914 9 Not in stock false This gRNA is designed based on basic rules of gRNA for CRISPR: 20bp upstream to PAM site false Shan, Zhe BBa_K1473020_sequence 1 gataagcagtttcatacaacgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z