BBa_B1002 1 BBa_B1002 Terminator (artificial, small, %T~=85%) 2006-08-29T11:00:00Z 2015-08-31T04:07:21Z antiquity Artifical terminator, estimated %T~=85 false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 6 residues. true Haiyao Huang annotation1898412 1 B1002 range1898412 1 1 34 annotation1898414 1 Poly A tail range1898414 1 25 31 annotation1898415 1 Poly A tail range1898415 1 4 9 annotation1898413 1 stem loop range1898413 1 10 25 BBa_K1475003 1 BBa_K1475003 tetracyclin repressor from transposon Tn10 2014-10-04T11:00:00Z 2015-05-08T01:10:39Z This part was constructed from the tetracycline repressor from transposon Tn10 (+LVA) (Part:BBa_C0040) using primers to remove the LVA protein digestion tag. That is THIS PART DOES NOT CONTAIN THE LVA PROTEIN DIGESTION TAG. This part contains the coding sequence of the TetR protein. TetR binds to the pTet promoter and represses transcription. aTc (anhydrotetracycline) bind to the TetR protein and inhibits the function of TetR. false false _1854_ 0 20911 9 It's complicated false Skrive hvilke primere der er brugt. false Daniel Weltz Pedersen annotation2420139 1 ATG range2420139 1 1 3 annotation2420140 1 TAATAA range2420140 1 622 627 BBa_K1475004 1 BBa_K1475004 Cons. promoter, RBS, TetR and a double terminator 2014-10-04T11:00:00Z 2015-05-08T01:10:39Z - This device will produce the TetR protein (Part:BBa_K1475003) using a constitutive promoter (Part:BBa_J23106) and RBS (Part:BBa_B0030) followed by a small artificial terminator (Part:BBa_B1002). false false _1854_ 0 20911 9 It's complicated false - false Daniel Weltz Pedersen component2423696 1 BBa_B0030 component2423701 1 BBa_K1475003 component2423706 1 BBa_B1002 component2423698 1 BBa_K1088022 component2423694 1 BBa_J23106 annotation2423696 1 BBa_B0030 range2423696 1 36 50 annotation2423706 1 BBa_B1002 range2423706 1 684 717 annotation2423694 1 BBa_J23106 range2423694 1 1 35 annotation2423701 1 BBa_K1475003 range2423701 1 57 683 annotation2423698 1 BBa_K1088022 range2423698 1 51 56 BBa_K1088022 1 BBa_K1088022 TACTAG 2013-09-16T11:00:00Z 2015-05-08T01:09:06Z TACTAG Short DNA piece (TACTAG) false false _1398_ 0 17057 9 Not in stock false 6 random nucleotides false Patrick Rosendahl Andreassen BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_K1475003_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtcctaataa BBa_K1475004_sequence 1 tttacggctagctcagtcctaggtatagtgctagcattaaagaggagaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtcctaataacgcaaaaaaccccgcttcggcggggttttttcgc BBa_B1002_sequence 1 cgcaaaaaaccccgcttcggcggggttttttcgc BBa_K1088022_sequence 1 tactag BBa_B0030_sequence 1 attaaagaggagaaa BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z